Skip to main content

Table 1 Oligonucleotide primers used for detection of vacA , cagA , oipA and iceA virulence factors of Helicobacter pylori strains isolated from milk and dairy products[19, 20]

From: Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran

Gene name Primer sequence (5’-3’) Size of product (bp)
vacA F: GCCGATATGCAAATGAGCCGC 678
  R: CAATCGTGTGGGTTCTGGAGC  
cag A F: AATACACCAACGCCTCCAAG 400
  R: TTGTTGGCGCTTGCTCTC  
iceA F: CGTTGGGTAAGCGTTACAGAATTT 557
  R: TCATTGTATATCCTATCATTACAAG  
oip A F: GTTTTTGATGCATGGGATTT 401
  R: GTGCATCTCTTATGGCTTT