Skip to main content

Table 1 Primer design of gene-specific primers and PCR product size

From: Cloning, structural modelling and characterization of VesT2s, a wasp venom hyaluronidase (HAase) from Vespa tropica

Forward primer Reverse primer Product size (bp)
Full nucleotide sequence active form
F4 GCCAGACTTTTCATGGAGGA (GSP1 for active) R3 (7) ATCAGGGGTCAGTTCACGTC (GSP1 for active) 225
Adaptor primer (AP)
5′GGCCACGCGTCGACTAGTAC (T) 16
(GSP for cDNA synthesis of 3′ RACE system)
R4 (8) CGTCGGTCTCGGTAAGAAAA  
Abridged universal amplification primer (AUAP) R5 (9) GTTCTCGTGCATCGCTGTAA  
VesT2a (F) NcoI
CCATGGCTTCCGAGAGACC
VesT2a (R) XhoI
CTCGAGTTAGTTAACGGCTTCTG
 
Full nucleotide sequence inactive form
F1 CGAAAAGGAAGCGTCGAATA
(GSP for RT-PCR inactive form)
R1 CATCTTGTCGTTCTCGCTCA (GSP for RT-PCR inactive form) 190
F2 CTTCGGCGTCTATTTCAAGG (GSP for RT-PCR inactive form) R2CCGCTAAGACAGTGGGGATA (GSP for inactive form) 229
Adaptor primer (AP)
5′GGCCACGCGTCGACTAGTAC (T) 16
(GSP for cDNA synthesis of 3′ RACE system)
R2 (1) CATCTTGTCGTTCTCGCTCA (GSP for RT-PCR inactive form)  
Abridged universal amplification primer (AUAP) R1 (2) CCGCTAAGACAGTGGGGATA (GSP for inactive form)  
  1. The bold letters represent the restriction sites