Skip to main content

Table 1 Primers and condition of amplification used in the study

From: Association among H. pylori virulence markers dupA, cagA and vacA in Brazilian patients

Primers Primer sequence (5′-3′) Amplification condition Gene Reference
DupA 1 CGTGATCAATATGGATGCTT 35 cycles: 45 s, 94°C; 45 s, 52°C and 45 s, 72°C dupA Gomes et al.[6]
DupA 2 TCTTTCTAGCTTGAGCGA
Cag1 ATGACTAACGAAACTATTGATC 40 cycles: 1 min, 94°C; 1 min, 53°C and 1 min, 72°C cagA Rasmussen et al.[9]
Cag2 CAGGATTTTTGATCGCTTTATT
Hpx1a CTGGAGARACTAAGYCCTCC 40 cycles: 1 min, 94°C; 1 min, 59°C and 1 min, 72°C 16S rRNA Scholte et al. [12]
Hpx2 GAGGAATACTCATTGCGAAGGCGA
SA ATGGAAATACAACAAACACAC 40 cycles: 45 s, 94°C; 45 s, 54°C and 45 s, 72°C vacA-s Atherton et al. [13]
SCa CCTGARACCGTTCCTACAGC Doorn et al. [14]
MAa CACAGCCACTTTYAATAACGA 35 cycles at: 45 s, 94°C, 45 s, 55°C and 1 min, 72°C vacA-m Doorn et al. [14]
MB CGTCAAAATAATTCCAAGGG
  1. •Genotype vacA: s1/m1 – strain 60190 of H. pylori (GeneBank U05676).
  2. •Genotype vacA: s2/m2 – strain Tx30a of H. pylori (GeneBank U29401).
  3. aR = a A or G and Y = C or T.